Sanger Sequencing on ABI 3730
- Submission Guide
- High throughput sequencing from 96-well plates
- Sequencing projects (primer walk)
- Sequencing template preparation guidelines
Automated Cycle Sequencing
ABI 3730XL
How Sequencing Is Done
- Template (DNA) Preparation
Type of DNA templates sequenced – PCR product, Plasmid, Phage/cosmid, BAC clones etc. After generation, PCR products need to be purified to remove excess primers and 4 dNTPs. Purification can be done either enzymatically, or by passing through a column or from a gel. Other templates, e.g. plasmids are usually prepared in sequence quality grade. - Cycle Sequencing Reaction by Sanger’s dideoxy Terminator Method on a PCR Machine
Components – DNA, primer, heat resistant DNA polymerase, 4 dNTPs, 4 dideoxy terminator nucleotides (4 ddNTPs) fluorescently labeled with 4 different dyes, and enzyme buffer containing Mg++, K+. Unlike PCR, only 1 primer is needed for sequencing. In PCR the genomic region of interest is amplified exponentially producing double stranded amplicons. For sequencing the single primer binds to the complimentary DNA strand and extends itself in a linear fashion. Extension goes on until by chance a particular ddNTP is incorporated depending on the complimentary base. Because of the latter’s dideoxy-configuration the polymerase can not add any other base to this fragment – the extension is terminated. Thus at the end of 25 to 40 cycles depending on the size of the template, numerous fragments are generated, having different lengths and a tagged nucleotide at the end. Stoichiometric manipulations of the reaction components ensures that the fragments of every possible length starting from n+1 to say 1000 bases are generated, n being the number of bases in the primer. Basic fact: Only 1 strand can be sequenced in 1 reaction and a primer can not read itself. - Post-Sequencing Reaction Cleanup
The cleanup is necessary to remove excess primers, dNTPs, tagged ddNTP’s and salts from the reaction products. The purification is done by using ABI’s BigDye Xterminator kit – no more dye blobs. Now the samples are ready to go on the sequencer. All of the above steps are done in 96-well plates. - Fragment Separation by Capillary Electrophoresis on ABI 96-capillary 3730XL Sequencer
The samples are electrokinetically injected into the array of capillaries, The negatively charged fragments migrate toward the anode by size, the smallest ones move fastest. Their tagged ddNTP terminators can be read as the fragment’s base sequence. A laser beam excites these dye molecules as the fragments reach a detection window producing fluorescent signals that are collected from all 96-capillaries at once, spectrally separated and focused onto a CCD camera. Very sophisticated optical and electronic devices produce a color readout that is translated, with the help of a sequence analysis software, into a sequence, as we see it. - Data Analysis
After editing, sequence data is blasted in the NCBI Genebank for identification, data mining or is aligned against reference sequences by using different software.
Description of Service
The facility uses two ABI (Applied Biosystems) sequencers: one 96-capillary 3730XL and one 16-capillary 3130XL sequencer. The sequencing is done on 3730XL with BigDye Taq FS Terminator V 3.1. The genotyping and fragment sizing are done on 3130XL;. Please consult our recommendations for template preparation to avoid failures. Standard primers (listed below) are provided by the facility at no charge. Custom primers are to be provided by the user, the facility no longer synthesizes primers.
Compared to the previous generation ABI 3700 sequencer, the 3730XL offers enhanced data quality and more successful samples per run, minimum reagent and sample consumption, high reliability, easy maintenance, and automated operation with accurate sample tracking. It generates enormous amounts of information faster and at a lower cost. The sequence length of read (LOR) is routinely more than 700 bases with < 2% error or ambiguity. Users can either choose to have the full sequencing reaction done at the facility, or provide ready-to-load samples (reaction and purification done by user). Our latest offer is high throughput DNA Sequencing at a low introductory price. Please use the relevant link for more information.
The turn around time has recently been reduced to one working day for all samples submitted by 3:30 PM with only occasional exceptions due to staff shortage, very high demand, and/or equipment failure. More and more emphasis is being put on the quality of the sequencing data. Every sequence result is looked at for overall quality, and accuracy of the base call. Whenever necessary, the samples are either reanalyzed with a different base caller and the bases edited, or reloaded to improve the quality. In some cases, samples are resequenced at no extra cost. Network licenses for the most common sequence analysis software like Mac Vector, Sequencher, Vector NTI are available from the Penn Molecular Profiling Group. Facility staff will consult with users whenever there are problems, and will make suggestions to improve sequencing results for regular and difficult templates.
As indicated on the sequencing submission site and the Submission Guide, please provide only requisite amount of template (or template + primer mix) for each reaction in a separate conjoined 0.2 ml strip tubes. This is necessary so that the samples can be processed on Biomek robot. Users may request that templates and primers be kept at the facility if they are being used in an active sequencing project.
The following standard primers are provided by the Facility at no charge:
| Primer | Sequence | Bases | MW | Tm (50 mM Na+) °C |
|---|---|---|---|---|
| Primer | Sequence | Bases | MW | Tm (50 mM Na) °C |
| M13/pUC Forward | 5′ CCC AGT CAC GAC GTT GTA AAA CG 3′ | 23 | 7018 | 65 |
| M13/pUC Reverse | 5′ AGC GGA TAA CAA TTT CAC ACA GG 3′ | 23 | 7065 | 61 |
| M13 Forward (-21) | 5′ TGT AAA ACG ACG GCC AGT 3′ | 18 | 5533 | 54 |
| M13 Reverse (-26) | 5′ CAG GAA ACA GCT ATG ACC 3′ | 18 | 5502 | 54 |
| Sp6 promoter/primer | 5′ ATT TAG GTG ACA CTA TAG AA 3′ | 20 | 6164 | 50 |
| T3 promoter/primer | 5′ ATT AAC CCT CAC TAA AGG GA 3′ | 20 | 6094 | 54 |
| T7 promoter/primer | 5′ TAA TAC GAC TCA CTA TAG GG 3′ | 20 | 6125 | 54 |
| T7 terminator | 5′ GCT AGT TAT TGC TCA GCG G 3′ | 19 | 5835 | 57 |
| gt 10 Forward | 5′ CCT TTT GAG CAA GTT CAG CCT GG 3′ | 23 | 7031 | 65 |
| gt 10 Reverse | 5′ GGT GGC TTA TGA GTA TTT CTT CC 3′ | 23 | 7052 | 61 |
| gt 11 Forward | 5′ ATT GGT GGC GAC GAC TCC TGG AG 3′ | 23 | 7121 | 68 |
| gt 11 Reverse | 5′ CAG ACC AAC TGG TAA TGG TAG C 3′ | 22 | 6769 | 62 |
| CMV Forward | 5′ CGC AAA TGG GCG GTA GGC GTG 3′ | 21 | 6552 | 76 |
| BGH Reverse (pcDNA 3.1) | 5′ TAG AAG GCA CAG TCG AGG 3′ | 18 | 5598 | 56 |
| Human U6.F | ACTATCATATGCTTACCGTAAC | 22 | 6653 | 54 |
| pJET1.2 Forward | 5’ CGA CTC ACT ATA GGG AGA GCG GC 3’ | 23 | 7099 | 61 |
| pJET1.2 Reverse | 5’ AAG AAC ATC GAT TTT CCA TGG CAG 3’ | 24 | 7361 | 56 |